Review



random blood glucose 16 7 mmol l rhadamts13  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    R&D Systems random blood glucose 16 7 mmol l rhadamts13
    ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or <t>rhADAMTS13</t> (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.
    Random Blood Glucose 16 7 Mmol L Rhadamts13, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/Recombinant+Human+ADAMTS13+Protein%2C+CF/pmc13037144-108-11-18
    Average 94 stars, based on 34 article reviews
    random blood glucose 16 7 mmol l rhadamts13 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "ADAMTS13 ameliorates diabetic nephropathy by Nrf2/GPX4/eNOS signaling pathway"

    Article Title: ADAMTS13 ameliorates diabetic nephropathy by Nrf2/GPX4/eNOS signaling pathway

    Journal: Renal Failure

    doi: 10.1080/0886022X.2026.2646089

    ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or rhADAMTS13 (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.
    Figure Legend Snippet: ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or rhADAMTS13 (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.

    Techniques Used: In Vivo, Control, Injection, Immunohistochemical staining, Staining, Expressing

    Related Articles

    Purification:

    Article Title: Cleavage by MMP‐13 renders VWF unable to bind to collagen but increases its platelet reactivity
    Article Snippet: MMP‐13 GST‐Hemopexin (Hpx) domain was expressed in E coli using the pGEX‐2T expression vector, the forward primer TCCGCGTGGATCCCTCTATGGTCCAGGAGATGAA and the reverse primer GCAA‐ATTCCATTTTGTGGTGTTGAAGAATTCAT, which contain BamHI and EcoRI restriction sites, respectively, as previously described. .. Purified human VWF (ab88533; abcam) at 0.2 mg/mL (final concentration in Tris pH 7.4) was incubated with MMP‐13 or ADAMTS13 (6156‐AD‐020; R&D Systems) at 1.5 μmol/L final enzyme concentration for 2 hours at 37°C. ..

    Concentration Assay:

    Article Title: Cleavage by MMP‐13 renders VWF unable to bind to collagen but increases its platelet reactivity
    Article Snippet: MMP‐13 GST‐Hemopexin (Hpx) domain was expressed in E coli using the pGEX‐2T expression vector, the forward primer TCCGCGTGGATCCCTCTATGGTCCAGGAGATGAA and the reverse primer GCAA‐ATTCCATTTTGTGGTGTTGAAGAATTCAT, which contain BamHI and EcoRI restriction sites, respectively, as previously described. .. Purified human VWF (ab88533; abcam) at 0.2 mg/mL (final concentration in Tris pH 7.4) was incubated with MMP‐13 or ADAMTS13 (6156‐AD‐020; R&D Systems) at 1.5 μmol/L final enzyme concentration for 2 hours at 37°C. ..

    Incubation:

    Article Title: Cleavage by MMP‐13 renders VWF unable to bind to collagen but increases its platelet reactivity
    Article Snippet: MMP‐13 GST‐Hemopexin (Hpx) domain was expressed in E coli using the pGEX‐2T expression vector, the forward primer TCCGCGTGGATCCCTCTATGGTCCAGGAGATGAA and the reverse primer GCAA‐ATTCCATTTTGTGGTGTTGAAGAATTCAT, which contain BamHI and EcoRI restriction sites, respectively, as previously described. .. Purified human VWF (ab88533; abcam) at 0.2 mg/mL (final concentration in Tris pH 7.4) was incubated with MMP‐13 or ADAMTS13 (6156‐AD‐020; R&D Systems) at 1.5 μmol/L final enzyme concentration for 2 hours at 37°C. ..

    other:

    Article Title: Recognition of PF4-VWF complexes by heparin-induced thrombocytopenia antibodies contributes to thrombus propagation
    Article Snippet: To accomplish this, hPF4-VWF-HIT antibody complexes were allowed to form and then exposed to the following interventions flowed through the channels at 10 dynes/cm 2 for 10 minutes: unfractionated porcine heparin (heparin, 0-50 units/mL final concentration, Novaplus), a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13, 0-7 nM, R&D Systems), and N -acetylcysteine (NAC, 0-10 mg/mL final concentration, AuroMedics).

    Activity Assay:

    Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13.
    Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. ADAMTS13 (2.5 nM) as wild-type (R&D Systems: 6156-AD) or as ADAMTS13-BirA* was reacted with FRETS-VWF73 (1 μM) in FRETS buffer (20 mM Tris–HCl, 25 mM CaCl2, 0.05% Tween-20, pH 7.4) and the activity was measured using SpectraMax M3 (Molecular Devices) fluorescence mode at ex = 340 nm and em = 450 nm. .. The proteolysis rate was calculated by linear regression of the initial slope of the measured activity using SoftMax Pro (v5.4).

    Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13
    Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. ADAMTS13 (2.5 nM) as wild-type (R&D Systems: 6156-AD) or as ADAMTS13-BirA* was reacted with FRETS-VWF73 (1 μM) in FRETS buffer (20 mM Tris–HCl, 25 mM CaCl 2 , 0.05% Tween-20, pH 7.4) and the activity was measured using SpectraMax M3 (Molecular Devices) fluorescence mode at ex = 340 nm and em = 450 nm. .. The proteolysis rate was calculated by linear regression of the initial slope of the measured activity using SoftMax Pro (v5.4).

    Fluorescence:

    Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13.
    Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. ADAMTS13 (2.5 nM) as wild-type (R&D Systems: 6156-AD) or as ADAMTS13-BirA* was reacted with FRETS-VWF73 (1 μM) in FRETS buffer (20 mM Tris–HCl, 25 mM CaCl2, 0.05% Tween-20, pH 7.4) and the activity was measured using SpectraMax M3 (Molecular Devices) fluorescence mode at ex = 340 nm and em = 450 nm. .. The proteolysis rate was calculated by linear regression of the initial slope of the measured activity using SoftMax Pro (v5.4).

    Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13
    Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. ADAMTS13 (2.5 nM) as wild-type (R&D Systems: 6156-AD) or as ADAMTS13-BirA* was reacted with FRETS-VWF73 (1 μM) in FRETS buffer (20 mM Tris–HCl, 25 mM CaCl 2 , 0.05% Tween-20, pH 7.4) and the activity was measured using SpectraMax M3 (Molecular Devices) fluorescence mode at ex = 340 nm and em = 450 nm. .. The proteolysis rate was calculated by linear regression of the initial slope of the measured activity using SoftMax Pro (v5.4).



    Similar Products

    94
    R&D Systems random blood glucose 16 7 mmol l rhadamts13
    ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or <t>rhADAMTS13</t> (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.
    Random Blood Glucose 16 7 Mmol L Rhadamts13, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/Recombinant+Human+ADAMTS13+Protein%2C+CF/pmc13037144-108-11-18
    Average 94 stars, based on 1 article reviews
    random blood glucose 16 7 mmol l rhadamts13 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Novus Biologicals adamts13
    ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or <t>rhADAMTS13</t> (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.
    Adamts13, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/ADAMTS13+Antibody+(20A5)/pm41557908-75-12-13
    Average 94 stars, based on 1 article reviews
    adamts13 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    85
    Thermo Fisher gene exp adamts13 hs00260148 m1
    Chromatin interactions and regulatory landscape at the ABO and <t>ADAMTS13</t> loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .
    Gene Exp Adamts13 Hs00260148 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/Gene+Exp%2E+ADAMTS13%2C+Hs00260148_m1/pmc12765440-62-24-29
    Average 85 stars, based on 1 article reviews
    gene exp adamts13 hs00260148 m1 - by Bioz Stars, 2026-09
    85/100 stars
      Buy from Supplier

    86
    Rotem Industries full length adamts13
    Chromatin interactions and regulatory landscape at the ABO and <t>ADAMTS13</t> loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .
    Full Length Adamts13, supplied by Rotem Industries, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/adamts13+full+length/pm41058374-120-14-16
    Average 86 stars, based on 1 article reviews
    full length adamts13 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Takeda recombinant adamts13
    Chromatin interactions and regulatory landscape at the ABO and <t>ADAMTS13</t> loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .
    Recombinant Adamts13, supplied by Takeda, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/adamts13+recombinant/pmc12446935-62-13-15
    Average 86 stars, based on 1 article reviews
    recombinant adamts13 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc adamts13 ab
    Chromatin interactions and regulatory landscape at the ABO and <t>ADAMTS13</t> loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .
    Adamts13 Ab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/pmc12531911-25-16-14
    Average 86 stars, based on 1 article reviews
    adamts13 ab - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    93
    Elabscience Biotechnology adamts13 antigen
    Chromatin interactions and regulatory landscape at the ABO and <t>ADAMTS13</t> loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .
    Adamts13 Antigen, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/Human+VWFCP%2FADAMTS13+(Von+Willebrand+Factor+Cleaving+Protease)+ELISA+Kit/pmc12334859-117-0-8
    Average 93 stars, based on 1 article reviews
    adamts13 antigen - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Elabscience Biotechnology vwfcp adamts13 elisa kits
    Chromatin interactions and regulatory landscape at the ABO and <t>ADAMTS13</t> loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .
    Vwfcp Adamts13 Elisa Kits, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/adamts13/Human+VWFCP%2FADAMTS13+(Von+Willebrand+Factor+Cleaving+Protease)+ELISA+Kit/pmc12334859-117-5-8
    Average 93 stars, based on 1 article reviews
    vwfcp adamts13 elisa kits - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or rhADAMTS13 (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.

    Journal: Renal Failure

    Article Title: ADAMTS13 ameliorates diabetic nephropathy by Nrf2/GPX4/eNOS signaling pathway

    doi: 10.1080/0886022X.2026.2646089

    Figure Lengend Snippet: ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or rhADAMTS13 (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.

    Article Snippet: Hyperglycemia was defined as a fasting blood glucose ≥11.1 mmol/L or random blood glucose ≥16.7 mmol/L. rhADAMTS13 (4245-AD, R&D Systems, Minneapolis, MN) was dissolved in saline and administered to mice via tail vein injections.

    Techniques: In Vivo, Control, Injection, Immunohistochemical staining, Staining, Expressing

    Chromatin interactions and regulatory landscape at the ABO and ADAMTS13 loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .

    Journal: Human Genetics and Genomics Advances

    Article Title: A non-coding ABO regulatory variant associatedwith VWF levels, thrombosis risk, and COVID-19 severity is topologically linked to ADAMTS13 in endothelial cells

    doi: 10.1016/j.xhgg.2025.100550

    Figure Lengend Snippet: Chromatin interactions and regulatory landscape at the ABO and ADAMTS13 loci in endothelial cells (A) Hi-C data from HUVECs showing chromatin interactions within a segment of chromosome 9, encompassing the ABO and ADAMTS13 loci. Three loop boundaries (L1, L2, L3) are identified, indicating regions anchoring chromatin loops. (B) Detailed epigenomic landscape of the ABO and ADAMTS13 loci, corresponding to the region amplified in (C). Data from multiple assays are shown. RNA-seq data from HUVEC showing gene expression levels at the ABO and ADAMTS13 loci. ADAMTS13 is expressed in HUVECs, whereas ABO shows no detectable expression in this cell type. ChIA-PET (CTCF): identifies CTCF-binding at L1, L2, and L3, suggesting these sites demarcate loop boundaries. DNase-seq: reveals accessible chromatin regions aligning with the loop anchors. ChIP-seq for RAD21 (cohesin): confirms cohesin enrichment at L1, L2, and L3. ChIP-seq data for HBMECs identify CTCF binding sites, while DNase-seq reveals accessible chromatin regions at L1, L2, and L3. (C) Drawn chromatin interaction model of the ABO and ADAMTS13 loci based on epigenomic and chromatin conformation data integrating Hi-C, ChIA-PET, DNase-seq, and ChIP-seq data from HUVEC, created with BioRender.com .

    Article Snippet: Quantitative PCR was conducted with TaqMan Fast Advanced Master Mix (Applied Biosystems, catalog no. 4444556) and TaqMan probes for ADAMTS13 (Applied Biosystems, catalog no. Hs00260148_m1) and glyceraldehyde 3-phosphate dehydrogenase (Applied Biosystems, catalog no. Hs02786624_g1).

    Techniques: Hi-C, Amplification, RNA Sequencing, Gene Expression, Expressing, ChIA Pet Assay, Binding Assay, ChIP-sequencing

    Functional testing and motif evaluation of non-coding variants at the ABO locus (A) Tables summarizing phenotypes previously associated with the non-coding variants rs657152 and rs505922 at the ABO locus. (B) Results of CRISPRa activation assays targeting the regions containing rs657152 and rs505922 in HUVECs. Three sgRNAs were used to activate transcription at each locus. The region harboring rs657152 demonstrated a significant increase in ADAMTS13 expression ( p < 0.05), supporting its role as a cis -regulatory element. In contrast, targeting the rs505922 region showed no significant activation. Data are represented as average fold change relative to control, with each point being a technical replicate ( n = 3). (C) Results of luciferase reporter assays for the genomic regions containing rs657152 and rs505922. For each variant, constructs containing either the risk or non-risk allele were tested in HUVECs to evaluate allele-specific transcriptional activity. The assay showed that the risk allele of rs505922 significantly reduced luciferase activity compared to the non-risk allele ( p < 0.05). In contrast, no statistically significant difference was observed between the alleles of rs657152. Data are represented as average luciferase activity relative to control, normalized with Renilla luciferase activity, with each point being a technical replicate ( n = 3) for each variant. (D) Motif analysis for the genomic regions containing rs657152 and rs505922. The in silico analysis demonstrated allele-specific transcription factor binding motifs for both variants. Substitution of the risk and non-risk alleles resulted in distinct motif profiles.

    Journal: Human Genetics and Genomics Advances

    Article Title: A non-coding ABO regulatory variant associatedwith VWF levels, thrombosis risk, and COVID-19 severity is topologically linked to ADAMTS13 in endothelial cells

    doi: 10.1016/j.xhgg.2025.100550

    Figure Lengend Snippet: Functional testing and motif evaluation of non-coding variants at the ABO locus (A) Tables summarizing phenotypes previously associated with the non-coding variants rs657152 and rs505922 at the ABO locus. (B) Results of CRISPRa activation assays targeting the regions containing rs657152 and rs505922 in HUVECs. Three sgRNAs were used to activate transcription at each locus. The region harboring rs657152 demonstrated a significant increase in ADAMTS13 expression ( p < 0.05), supporting its role as a cis -regulatory element. In contrast, targeting the rs505922 region showed no significant activation. Data are represented as average fold change relative to control, with each point being a technical replicate ( n = 3). (C) Results of luciferase reporter assays for the genomic regions containing rs657152 and rs505922. For each variant, constructs containing either the risk or non-risk allele were tested in HUVECs to evaluate allele-specific transcriptional activity. The assay showed that the risk allele of rs505922 significantly reduced luciferase activity compared to the non-risk allele ( p < 0.05). In contrast, no statistically significant difference was observed between the alleles of rs657152. Data are represented as average luciferase activity relative to control, normalized with Renilla luciferase activity, with each point being a technical replicate ( n = 3) for each variant. (D) Motif analysis for the genomic regions containing rs657152 and rs505922. The in silico analysis demonstrated allele-specific transcription factor binding motifs for both variants. Substitution of the risk and non-risk alleles resulted in distinct motif profiles.

    Article Snippet: Quantitative PCR was conducted with TaqMan Fast Advanced Master Mix (Applied Biosystems, catalog no. 4444556) and TaqMan probes for ADAMTS13 (Applied Biosystems, catalog no. Hs00260148_m1) and glyceraldehyde 3-phosphate dehydrogenase (Applied Biosystems, catalog no. Hs02786624_g1).

    Techniques: Functional Assay, Activation Assay, Expressing, Control, Luciferase, Variant Assay, Construct, Activity Assay, In Silico, Binding Assay