random blood glucose 16 7 mmol l rhadamts13 (R&D Systems)
Structured Review

Random Blood Glucose 16 7 Mmol L Rhadamts13, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/adamts13/Recombinant+Human+ADAMTS13+Protein%2C+CF/pmc13037144-108-11-18
Average 94 stars, based on 34 article reviews
Images
1) Product Images from "ADAMTS13 ameliorates diabetic nephropathy by Nrf2/GPX4/eNOS signaling pathway"
Article Title: ADAMTS13 ameliorates diabetic nephropathy by Nrf2/GPX4/eNOS signaling pathway
Journal: Renal Failure
doi: 10.1080/0886022X.2026.2646089
Figure Legend Snippet: ADAMTS13 maintained renal function and attenuated renal fibrosis in vivo . Control mice were treated with vehicle (Control). The STZ-treated mice were infused with vehicle (DN) or rhADAMTS13 (DN + rhADAMTS13). rhADAMTS13 (2.6 ug/kg body weight) was injected into the tail vein daily for the subsequent 7 d. (A) The workflow of animal experiments. (B) Representative renal immunohistochemical staining of ADAMTS13 in the kidney. Scale Bar: 30 μm. (C) Representative renal morphological images of mice were shown. Hematoxylin-Eosin (HE), Masson’s trichrome and Periodic Acid-Schiff (PAS) staining of kidney slices. Scale Bar: 30 μm. (D) Body weight. (E) Serum glucose. (F) BUN. (G) Scr. (H) Urinary volume. (I) Proteinuria. (J) Urinary KIM-1. (K) Renal KIM-1 mRNA expression. ADAMTS13: a disintegrin and metalloprotease with a thrombospondin type 1 motif member 13; DN: diabetic nephropathy; BUN: blood urea nitrogen; Scr: serum creatinine; KIM-1: kidney injury molecule-1. Results were presented as mean ± SEM. N = 5, ** P < 0.01, *** P < 0.001, one-way ANOVA followed by Tukey’s post hoc test.
Techniques Used: In Vivo, Control, Injection, Immunohistochemical staining, Staining, Expressing
Related Articles
Purification:Article Title: Cleavage by MMP‐13 renders VWF unable to bind to collagen but increases its platelet reactivity Article Snippet: MMP‐13 GST‐Hemopexin (Hpx) domain was expressed in E coli using the pGEX‐2T expression vector, the forward primer TCCGCGTGGATCCCTCTATGGTCCAGGAGATGAA and the reverse primer GCAA‐ATTCCATTTTGTGGTGTTGAAGAATTCAT, which contain BamHI and EcoRI restriction sites, respectively, as previously described. .. Purified human VWF (ab88533; abcam) at 0.2 mg/mL (final concentration in Tris pH 7.4) was incubated with MMP‐13 or Concentration Assay:Article Title: Cleavage by MMP‐13 renders VWF unable to bind to collagen but increases its platelet reactivity Article Snippet: MMP‐13 GST‐Hemopexin (Hpx) domain was expressed in E coli using the pGEX‐2T expression vector, the forward primer TCCGCGTGGATCCCTCTATGGTCCAGGAGATGAA and the reverse primer GCAA‐ATTCCATTTTGTGGTGTTGAAGAATTCAT, which contain BamHI and EcoRI restriction sites, respectively, as previously described. .. Purified human VWF (ab88533; abcam) at 0.2 mg/mL (final concentration in Tris pH 7.4) was incubated with MMP‐13 or Incubation:Article Title: Cleavage by MMP‐13 renders VWF unable to bind to collagen but increases its platelet reactivity Article Snippet: MMP‐13 GST‐Hemopexin (Hpx) domain was expressed in E coli using the pGEX‐2T expression vector, the forward primer TCCGCGTGGATCCCTCTATGGTCCAGGAGATGAA and the reverse primer GCAA‐ATTCCATTTTGTGGTGTTGAAGAATTCAT, which contain BamHI and EcoRI restriction sites, respectively, as previously described. .. Purified human VWF (ab88533; abcam) at 0.2 mg/mL (final concentration in Tris pH 7.4) was incubated with MMP‐13 or other:Article Title: Recognition of PF4-VWF complexes by heparin-induced thrombocytopenia antibodies contributes to thrombus propagation Article Snippet: To accomplish this, hPF4-VWF-HIT antibody complexes were allowed to form and then exposed to the following interventions flowed through the channels at 10 dynes/cm 2 for 10 minutes: unfractionated porcine heparin (heparin, 0-50 units/mL final concentration, Novaplus), a disintegrin and metalloproteinase with a thrombospondin type 1 motif, Activity Assay:Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13. Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13 Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. Fluorescence:Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13. Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. Article Title: Optimization of plasma-based BioID identifies plasminogen as a ligand of ADAMTS13 Article Snippet: ADAMTS13 activity was quantified using a standardized fluorescent-labeled substrate, FRETS-VWF73 (AnaSpec: AS-63728-01). .. |
